Top » Catalog » J1 » FGC29872

$18.00

FGC29872
[FGC29872]

FGC29872
hg38 Position: ChrY:20386549..20386549
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC29872_F GCACTATATTAAGGTGGTAGTGTCCTG
Reverse Primer: FGC29872_R AGCAAAATAAGCCACCCTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies