Top » Catalog » J1 » FGC29873

$18.00

FGC29873
[FGC29873]

FGC29873
hg38 Position: ChrY:16507620..16507620
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: Aka ZS4956
Forward Primer: FGC29873_F CCACACACCCAAAGATTTACC
Reverse Primer: FGC29873_R CCCATGTGGTCACTAAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47437
1 x CTS11741
1 x FGC5205
1 x FGC42828
1 x A18933
1 x ALK396
1 x BY74
1 x CTS15
1 x FGC17478
1 x ALK199
1 x A18075
1 x A22248
1 x FGC39467
1 x B238
1 x ALK395
1 x FGC30416
1 x FGC16640
1 x FGC4768
1 x FGC31135
1 x FGC22745
1 x FGC6095
$378.00
Haplogroup Info
Other products
Currencies