Top » Catalog » J1 » FGC29873

$18.00

FGC29873
[FGC29873]

FGC29873
hg38 Position: ChrY:16507620..16507620
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J1
Comments: Aka ZS4956
Forward Primer: FGC29873_F CCACACACCCAAAGATTTACC
Reverse Primer: FGC29873_R CCCATGTGGTCACTAAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies