Top » Catalog » J1 » FGC31135

$18.00

FGC31135
[FGC31135]

FGC31135
hg38 Position: ChrY:19254798..19254798
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC31135_F AGTACTGAACAGTAGGTGCAGGATG
Reverse Primer: FGC31135_R CAGAACAGCGGATACTGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies