Top » Catalog » J1 » FGC31627

$18.00

FGC31627
[FGC31627]

FGC31627
hg38 Position: ChrY:7752416..7752416
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC31627_F GGAGACGAAGAGGCAAGG
Reverse Primer: FGC31627_R CAAAACCAGTAAAGGCATCTCC
Reviews

Customers who bought this product also purchased
FGC5486
FGC5486
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC29847
FGC29847
FGC1696
FGC1696
FGC4358
FGC4358
FGC34247
FGC34247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies