Top » Catalog » J1 » FGC31627

$18.00

FGC31627
[FGC31627]

FGC31627
hg38 Position: ChrY:7752416..7752416
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC31627_F GGAGACGAAGAGGCAAGG
Reverse Primer: FGC31627_R CAAAACCAGTAAAGGCATCTCC
Reviews

Customers who bought this product also purchased
BY2
BY2
FGC31133
FGC31133
FGC1707
FGC1707
FGC1713
FGC1713
FGC16640
FGC16640
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies