Top » Catalog » J1 » FGC5479

$18.00

FGC5479
[FGC5479]

FGC5479
hg38 Position: ChrY:11901163..11901163
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5479_F AATATCTTCCACCACTTACACGAG
Reverse Primer: FGC5479_R TATGCAAAGGTGAGGTTCAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC41745
1 x FGC4429
1 x FGC37526
1 x FGC29983
1 x BY81893
1 x FGC16658
1 x A17827
1 x A19271
1 x FGC5237
1 x FGC5488
1 x FGC42835
1 x FGC20860
$216.00
Haplogroup Info
Other products
Currencies