Top » Catalog » J1 » FGC5485

$18.00

FGC5485
[FGC5485]

FGC5485
hg38 Position: ChrY:17139523..17139523
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5485_F GAGTGAAGTAATGGAGACGGTCC
Reverse Primer: FGC5485_R GCTTTTCCCCAGTTCAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC47834
1 x ALK877
1 x BY13768
1 x FGC4326
1 x BY108
1 x BY66740
1 x FGC22239
1 x FGC5420
1 x FGC31378
1 x A14886
1 x FGC44943
1 x FGC10612
1 x BY68
$234.00
Haplogroup Info
Other products
Currencies