Top » Catalog » J1 » FGC5488

$18.00

FGC5488
[FGC5488]

FGC5488
hg38 Position: ChrY:19999353..19999353
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5488_F TCAAGTGCACCTCAGAAGTTTAAG
Reverse Primer: FGC5488_R CAATAGGGAGCAGCCCATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC42685
1 x FGC20888
1 x BY38100
1 x FGC42781
1 x A19217
1 x FGC16721
1 x FGC4452
1 x ALK253
1 x FGC48180
1 x FGC4243
1 x FGC31327
1 x ALK29
1 x FGC20883
1 x FGC5206
1 x FGC16723
1 x ALK869
1 x A19265
1 x A15546
$324.00
Haplogroup Info
Other products
Currencies