Top » Catalog » J1 » FGC5488

$18.00

FGC5488
[FGC5488]

FGC5488
hg38 Position: ChrY:19999353..19999353
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5488_F TCAAGTGCACCTCAGAAGTTTAAG
Reverse Primer: FGC5488_R CAATAGGGAGCAGCCCATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies