Top » Catalog » J1 » FGC5234

$18.00

FGC5234
[FGC5234]

FGC5234
hg38 Position: ChrY:16019293..16019293
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Below L858
Forward Primer: FGC5234_F GCATCTGTCTTTATAGTAGCATGATTTAC
Reverse Primer: FGC5234_R CAACATGCAGAATGGGAGAC
Reviews

Customers who bought this product also purchased
FGC59170
FGC59170
FGC59116
FGC59116
FGC62573
FGC62573
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC15762
FGC15762
FGC41680
FGC41680
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
1 x FGC4288
1 x ALK96
$432.00
Haplogroup Info
Other products
Currencies