Top » Catalog » J1 » FGC5234

$18.00

FGC5234
[FGC5234]

FGC5234
hg38 Position: ChrY:16019293..16019293
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: Below L858
Forward Primer: FGC5234_F GCATCTGTCTTTATAGTAGCATGATTTAC
Reverse Primer: FGC5234_R CAACATGCAGAATGGGAGAC
Reviews

Customers who bought this product also purchased
FGC59170
FGC59170
FGC59116
FGC59116
FGC62573
FGC62573
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC15762
FGC15762
FGC41680
FGC41680
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies