Top » Catalog » J1 » FGC1729

$19.00

FGC1729
[FGC1729]

FGC1729
hg38 Position: ChrY:20360318..20360318
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC1729_F CATGCCTCTCTTTCCTGTCC
Reverse Primer: FGC1729_R AATGCTGACAAGATCTGAAAAATG
Reviews

Customers who bought this product also purchased
FGC1712
FGC1712
ZS8311
ZS8311
FGC40709
FGC40709
ZS5809
ZS5809
ZS6421
ZS6421
FGC1713
FGC1713
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies