Top » Catalog » J1 » FGC5432

$18.00

FGC5432
[FGC5432]

FGC5432
hg38 Position: ChrY:17347642..17347642
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5432_F GCCTCCTTGGGCTATTCC
Reverse Primer: FGC5432_R ACTCTGTAAAACAGACCAATCAACTC
Reviews

Customers who bought this product also purchased
HU394
HU394
ZS5198
ZS5198
Z18219
Z18219
FGC5425
FGC5425
FGC5431
FGC5431
FGC5435
FGC5435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4280
1 x ALK459
1 x FGC1715
1 x ALK29
1 x FGC7393
1 x A23500
$108.00
Haplogroup Info
Other products
Currencies