Top » Catalog » J1 » FGC5432

$18.00

FGC5432
[FGC5432]

FGC5432
hg38 Position: ChrY:17347642..17347642
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5432_F GCCTCCTTGGGCTATTCC
Reverse Primer: FGC5432_R ACTCTGTAAAACAGACCAATCAACTC
Reviews

Customers who bought this product also purchased
FGC5425
FGC5425
FGC5431
FGC5431
FGC5435
FGC5435
FGC4486
FGC4486
DNA Sample Kit
DNA Sample Kit
ZS5205
ZS5205
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies