Top » Catalog » J1 » FGC5423

$18.00

FGC5423
[FGC5423]

FGC5423
hg38 Position: ChrY:11779664..11779664
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5423_F CAATCTGCCTGCCTCAGG
Reverse Primer: FGC5423_R GGGAAAAATTGTAATACATAATCTCACAAC
Reviews

Customers who bought this product also purchased
FGC60667
FGC60667
HU394
HU394
FGC22249
FGC22249
DNA Sample Kit
DNA Sample Kit
ZS5205
ZS5205
BY145
BY145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies