Top » Catalog » J1 » FGC4469

$18.00

FGC4469
[FGC4469]

FGC4469
hg38 Position: ChrY:2996039..2996039
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4469_F TAACTTTCTGGACGGGGTTG
Reverse Primer: FGC4469_R AACCAGAAATAAGAGGGGACATTAC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC5462
FGC5462
ZS6400
ZS6400
FGC4486
FGC4486
FGC5468
FGC5468
FGC5427
FGC5427
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
1 x A17834
1 x FGC45005
1 x FGC4487
1 x FGC4411
1 x FGC7620
1 x ALK248
1 x FGC9585
1 x CTS3041
$216.00
Haplogroup Info
Other products
Currencies