Top » Catalog » J1 » FGC4487

$18.00

FGC4487
[FGC4487]

FGC4487
hg38 Position: ChrY:20462870..20462870
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC4
Comments: Downstream of J1-FGC4
Forward Primer: FGC4487_F GAAGGTCCACTCCAGACCAG
Reverse Primer: FGC4487_R GACATACCAGGAGATTATATCACGC
Reviews

Customers who bought this product also purchased
FGC4469
FGC4469
FGC4486
FGC4486
ZS6400
ZS6400
FGC5427
FGC5427
FGC5468
FGC5468
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies