Top » Catalog » J1 » FGC4494

$18.00

FGC4494
[FGC4494]

FGC4494
hg38 Position: ChrY:20931757..20931757
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4494_F AAAACATCATAATGACAGAATCGAAC
Reverse Primer: FGC4494_R CTTTATGAATCTGGGTTCTCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies