Top » Catalog » J1 » FGC45522

$18.00

FGC45522
[FGC45522]

FGC45522
hg38 Position: ChrY:7047261..7047261
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC45522_F CAAGACCATAAGCCCAAAGC
Reverse Primer: FGC45522_R CACCTTGTCCCTCCTGAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y13640
1 x Y18004
1 x BY11075
1 x BY46011
$72.00
Haplogroup Info
Other products
Currencies