Top » Catalog » J1 » FGC45522

$18.00

FGC45522
[FGC45522]

FGC45522
hg38 Position: ChrY:7047261..7047261
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC45522_F CAAGACCATAAGCCCAAAGC
Reverse Primer: FGC45522_R CACCTTGTCCCTCCTGAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK279
1 x FGC31327
1 x FGC4761
1 x ALK293
1 x FGC47354
1 x FGC50886
1 x FGC37526
1 x FGC23318
1 x FGC5464
1 x FGC20864
1 x A14639
1 x FGC37851
1 x FGC4353
$234.00
Haplogroup Info
Other products
Currencies