Top » Catalog » J1 » FGC5462

$18.00

FGC5462
[FGC5462]

FGC5462
hg38 Position: ChrY:8049521..8049521
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5462vl_F TGCTATTGTGAATAGTGCCACAAC
Reverse Primer: FGC5462vl_R GGATCTAATTAGACTAATGAGTTTTTGTG
Reviews

Customers who bought this product also purchased
FGC4469
FGC4469
FGC4486
FGC4486
ZS6400
ZS6400
FGC5427
FGC5427
FGC5468
FGC5468
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies