Top » Catalog » J1 » FGC5462

$18.00

FGC5462
[FGC5462]

FGC5462
hg38 Position: ChrY:8049521..8049521
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5462vl_F TGCTATTGTGAATAGTGCCACAAC
Reverse Primer: FGC5462vl_R GGATCTAATTAGACTAATGAGTTTTTGTG
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
FGC5468
FGC5468
FGC2
FGC2
ZS3873
ZS3873
FGC5
FGC5
FGC4487
FGC4487
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC45010
1 x FGC5435
1 x FGC4282
1 x ALK27
1 x FGC1712
1 x ALK251
1 x FGC48146
1 x FGC34373
1 x FGC4354
1 x FGC1720
1 x BY107
1 x BY82
1 x FGC4705
1 x ALK257
1 x A22549
1 x ALK885
1 x FGC50071
1 x FGC5421
1 x FGC4320
1 x FGC37836
$360.00
Haplogroup Info
Other products
Currencies