Top » Catalog » J1 » FGC5464

$18.00

FGC5464
[FGC5464]

FGC5464
hg38 Position: ChrY:16483032..16483032
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5464_F ATAAGGTCGCACCTGACCTG
Reverse Primer: FGC5464_R AATTCTGCAAATGCTGATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies