Top » Catalog » J1 » FGC5468

$18.00

FGC5468
[FGC5468]

FGC5468
hg38 Position: ChrY:22294351..22294351
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5468_F GGAGAAATATAATCTAATCTAGCTCTCTAAACC
Reverse Primer: FGC5468_R CAGAGAAACATGCCCTACAACTTC
Reviews

Customers who bought this product also purchased
FGC4469
FGC4469
FGC4486
FGC4486
ZS6400
ZS6400
FGC5427
FGC5427
ZS3873
ZS3873
FGC2
FGC2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies