Top » Catalog » J1 » FGC42773

$18.00

FGC42773
[FGC42773]

FGC42773
hg38 Position: ChrY:19919161..19919161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC42773_F ATGGACTGACAGAGAGAAACAGC
Reverse Primer: FGC42773_R TTACTTCCATCCTGGATGTATAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY9923
1 x FGC31455
1 x ALK505
1 x Y48563
1 x BY33069
$90.00
Haplogroup Info
Other products
Currencies