Top » Catalog » J1 » FGC42773

$18.00

FGC42773
[FGC42773]

FGC42773
hg38 Position: ChrY:19919161..19919161
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC42773_F ATGGACTGACAGAGAGAAACAGC
Reverse Primer: FGC42773_R TTACTTCCATCCTGGATGTATAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
1 x A19929
1 x BY13788
1 x FGC49261
1 x ALK576
1 x FGC23315
1 x FGC5468
1 x FGC7944
$306.00
Haplogroup Info
Other products
Currencies