Top » Catalog » J1 » FGC4441

$18.00

FGC4441
[FGC4441]

FGC4441
hg38 Position: ChrY:2910203..2910203
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4441_F AGGGTTGATAGTAATGTCCCTTCTG
Reverse Primer: FGC4441_R CTGGTCTGTGTTTGTCCAGC
Reviews

Customers who bought this product also purchased
FGC1713
FGC1713
ZS4995
ZS4995
FGC2
FGC2
FGC4459
FGC4459
FGC4452
FGC4452
FGC5
FGC5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies