Top » Catalog » J1 » FGC4708

$18.00

FGC4708
[FGC4708]

FGC4708
hg38 Position: ChrY:8544633..8544633
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4708_F GGAAATCCAGGTGAGAAACG
Reverse Primer: FGC4708_R TCTCAGCCTTATCCCCACTAAC
Reviews

Customers who bought this product also purchased
FGC4705
FGC4705
FGC4371
FGC4371
FGC7
FGC7
FGC1713
FGC1713
FGC1696
FGC1696
ZS8224
ZS8224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16979
$18.00
Haplogroup Info
Other products
Currencies