Top » Catalog » J1 » FGC5212

$18.00

FGC5212
[FGC5212]

FGC5212
hg38 Position: ChrY:7177562..7177562
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5212_F GGGTCAAGTGGGGGACTC
Reverse Primer: FGC5212_R CTTCGCAGTGAGTGTTGCTAC
Reviews

Customers who bought this product also purchased
FGC5240
FGC5240
FGC5231
FGC5231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
$180.00
Haplogroup Info
Other products
Currencies