Top » Catalog » J1 » FGC7944

$18.00

FGC7944
[FGC7944]

FGC7944
hg38 Position: ChrY:12336010..12336010
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: FGC7944v21_F TGGTGAAACCCCATCTCTACC
Reverse Primer: FGC7944v21_R AGTACCTGAAGGCTTCTTCTGC
Reviews

Customers who bought this product also purchased
ZS7229
ZS7229
FGC7936
FGC7936
FGC4243
FGC4243
FGC1695
FGC1695
FGC4340
FGC4340
ZS9483
ZS9483
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19930
1 x A20818
1 x FGC22751
1 x ALK443
1 x FGC5464
1 x ALK610
1 x FGC4415
1 x FGC4741
1 x A15548
1 x A14649
1 x FGC5462
1 x FGC6526
1 x FGC31627
1 x FGC10414
1 x FGC48145
1 x ALK138
1 x FGC37851
1 x FGC42175
$324.00
Haplogroup Info
Other products
Currencies