Top » Catalog » J1 » FGC7944

$18.00

FGC7944
[FGC7944]

FGC7944
hg38 Position: ChrY:12336010..12336010
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: FGC7944v21_F TGGTGAAACCCCATCTCTACC
Reverse Primer: FGC7944v21_R AGTACCTGAAGGCTTCTTCTGC
Reviews

Customers who bought this product also purchased
FGC4316
FGC4316
FGC51963
FGC51963
Z20775
Z20775
ZS11753
ZS11753
FGC6
FGC6
ZS7229
ZS7229
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY40604
1 x FGC16721
$36.00
Haplogroup Info
Other products
Currencies