Top » Catalog » J1 » BY4

$18.00

BY4
[BY4]

BY4
hg38 Position: ChrY:22300121..22300121
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC12 > FGC1695
Forward Primer: BY4_F ATCTCTTATCTGGGTAAGGGTCAG
Reverse Primer: BY4_R CTTGTCTCGAACTCCTGACATG
Reviews

Customers who bought this product also purchased
FGC4453
FGC4453
BY68843
BY68843
Y171684
Y171684
ZS11886
ZS11886
ZS11028
ZS11028
ZS11025
ZS11025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies