Top » Catalog » J1 » FGC42781

$18.00

FGC42781
[FGC42781]

FGC42781
hg38 Position: ChrY:7066643..7066643
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1695
Forward Primer: FGC42781v2_F GGCTCCACCTCTCAGGATTC
Reverse Primer: FGC42781v2_R TCAGCCCCCTGAGTACCTC
Reviews

Customers who bought this product also purchased
Y130515
Y130515
FGC60148
FGC60148
FGC60137
FGC60137
ZS10412
ZS10412
ZS10417
ZS10417
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies