Top » Catalog » J1 » FGC42781

$18.00

FGC42781
[FGC42781]

FGC42781
hg38 Position: ChrY:7066643..7066643
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1695
Forward Primer: FGC42781v2_F GGCTCCACCTCTCAGGATTC
Reverse Primer: FGC42781v2_R TCAGCCCCCTGAGTACCTC
Reviews

Customers who bought this product also purchased
FGC60152
FGC60152
Y78099
Y78099
Y181197
Y181197
ZS5226
ZS5226
ZS5230
ZS5230
ZS5224
ZS5224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies