Top » Catalog » J1 » FGC42797

$18.00

FGC42797
[FGC42797]

FGC42797
hg38 Position: ChrY:19972934..19972934
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1695
Forward Primer: FGC42797_F CCAAAACAGACATATAGAGCAATGG
Reverse Primer: FGC42797_R CTGACGTTTTAACAATCACCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies