Top » Catalog » J1 » FGC14446

$18.00

FGC14446
[FGC14446]

FGC14446
hg38 Position: ChrY:17157538..17157539
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC14446_F AACTAAACAGTGATTAGGAATCCTCTG
Reverse Primer: FGC14446_R ATTCACCTATTGACCCAACGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC48143
1 x FGC22261
1 x FGC22239
1 x FGC5430
$72.00
Haplogroup Info
Other products
Currencies