Top » Catalog » J1 » FGC50880

$18.00

FGC50880
[FGC50880]

FGC50880
hg38 Position: ChrY:10161226..10161226
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50880_F CCCTTGGTCATATGAGTAGATTGG
Reverse Primer: FGC50880_R CAAAACAGAGATATAGACCAATGGAATC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC50887
FGC50887
FGC50886
FGC50886
FGC50885
FGC50885
FGC50884
FGC50884
FGC50879
FGC50879
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies