Top » Catalog » J1 » FGC50071

$18.00

FGC50071
[FGC50071]

FGC50071
hg38 Position: ChrY:8194306..8194306
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50071_F CAGCAGAATCCTCTGCAGG
Reverse Primer: FGC50071_R GTTAGTTTTCCTTCTAACAGGTCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38802
1 x FGC15173
$36.00
Haplogroup Info
Other products
Currencies