Top » Catalog » J1 » FGC19504

$18.00

FGC19504
[FGC19504]

FGC19504
hg38 Position: ChrY:17016734..17016734
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC19502
Forward Primer: FGC19504_F TCCACCAGAGTTTCTTATTAGTGGTAG
Reverse Primer: FGC19504_R AGTGCAGTGGAACGATCTCAG
Reviews

Customers who bought this product also purchased
FGC4355
FGC4355
FGC19502
FGC19502
FGC19503
FGC19503
FGC19505
FGC19505
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies