Top » Catalog » J1 » FGC19505

$18.00

FGC19505
[FGC19505]

FGC19505
hg38 Position: ChrY:17381376..17381376
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC19502
Forward Primer: FGC19505_F TATAGTGAGCCAAGGTCACTGC
Reverse Primer: FGC19505_R CTAGAAAGACTGGCTCCTTACTTCAC
Reviews

Customers who bought this product also purchased
FGC19504
FGC19504
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
1 x A17834
1 x FGC45005
1 x FGC4487
$126.00
Haplogroup Info
Other products
Currencies