Top » Catalog » J1 » FGC31373

$18.00

FGC31373
[FGC31373]

FGC31373
hg38 Position: ChrY:8498946..8498946
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC31373_F TGTGCCATACATTTGAGAATATAACAC
Reverse Primer: FGC31373_R TCACAATGCTTCCCTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19076
1 x SK1396
1 x A2392
$54.00
Haplogroup Info
Other products
Currencies