Top » Catalog » J1 » FGC31376

$18.00

FGC31376
[FGC31376]

FGC31376
hg38 Position: ChrY:20973571..20973571
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC31376_F CCCAAGGCAACTTATGACTG
Reverse Primer: FGC31376_R TTTATTAGACACATTTTTGGCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23930
1 x FGC31133
1 x FGC1695
1 x FGC10026
1 x FGC28722
1 x ALK25
$108.00
Haplogroup Info
Other products
Currencies