Top » Catalog » J1 » FGC5421

$18.00

FGC5421
[FGC5421]

FGC5421
hg38 Position: ChrY:10155971..10155971
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5421_F GCCAGCAGATGACATCAATG
Reverse Primer: FGC5421_R CAGAGGAGGCTGGTAAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC7387
1 x FGC42829
1 x FGC7942
1 x ALK355
1 x FGC30566
1 x ALK98
1 x FGC22725
1 x FGC5430
1 x FGC8728
1 x FGC1729
1 x A24504
1 x ALK876
1 x FGC50901
1 x FGC10419
1 x ALK886
1 x FGC10601
1 x FGC3723
1 x FGC1687
1 x FGC8730
1 x FGC12805
1 x FGC44938
$378.00
Haplogroup Info
Other products
Currencies