Top » Catalog » J1 » FGC5429

$18.00

FGC5429
[FGC5429]

FGC5429
hg38 Position: ChrY:16761676..16761676
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5429_F CCTTTGTTGGATGCCTAGTCTG
Reverse Primer: FGC5429_R AAGCTACACACCTACAACCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23930
1 x FGC31133
1 x FGC1695
1 x FGC10026
1 x FGC28722
1 x ALK25
1 x FGC4781
1 x FGC45011
1 x BY152652
1 x FGC8727
1 x FGC17491
1 x FGC48149
1 x ALK742
1 x FGC30545
1 x ALK38
1 x FGC15760
1 x FGC37842
1 x BY13780
1 x FGC4814
1 x FGC10608
1 x FGC17487
1 x ALK394
$396.00
Haplogroup Info
Other products
Currencies