Top » Catalog » J1 » FGC5430

$18.00

FGC5430
[FGC5430]

FGC5430
hg38 Position: ChrY:16796002..16796002
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5430_F ATTTGCGTTTTTACCAACACATC
Reverse Primer: FGC5430_R CTGGGAGACTGAGGCTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23924
$18.00
Haplogroup Info
Other products
Currencies