Top » Catalog » J1 » FGC5433

$18.00

FGC5433
[FGC5433]

FGC5433
hg38 Position: ChrY:18931441..18931441
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5433_F TTTTTAAGCAGAAATGGAGAAGTG
Reverse Primer: FGC5433_R GCAGGAGAATTGCTTGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies