Top » Catalog » J1 » FGC5435

$18.00

FGC5435
[FGC5435]

FGC5435
hg38 Position: ChrY:19439315..19439315
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5435_F CATAAACAGAACCCATGAAAAAAG
Reverse Primer: FGC5435_R GAGTTCACTCATCATTTGGCTG
Reviews

Customers who bought this product also purchased
FGC5432
FGC5432
FGC5425
FGC5425
FGC5431
FGC5431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32028
1 x A23760
1 x FGC5911
$54.00
Haplogroup Info
Other products
Currencies