Top » Catalog » J1 » FGC5437

$18.00

FGC5437
[FGC5437]

FGC5437
hg38 Position: ChrY:21266705..21266705
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC5422 > FGC5424 > FGC5418 > FGC5420
Forward Primer: FGC5437_F TTGCCCAGACATTTTGACAG
Reverse Primer: FGC5437_R ATTCCTAAACCTCAGCCTCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK213
$18.00
Haplogroup Info
Other products
Currencies