Top » Catalog » J1 » FGC50952

$18.00

FGC50952
[FGC50952]

FGC50952
hg38 Position: ChrY:15252987..15252987
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50952_F TTATGGAGCTTGCTTCAGCTG
Reverse Primer: FGC50952_R AAAAAACTTTCTAGAGCTACTTTAAAATAAATG
Reviews

Customers who bought this product also purchased
FGC50953
FGC50953
FGC50951
FGC50951
FGC50950
FGC50950
FGC50949
FGC50949
FGC50948
FGC50948
FGC50954
FGC50954
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10416
1 x FGC6525
1 x FGC38711
1 x FGC10422
1 x FGC4338
1 x BY145
1 x A18553
1 x FGC1722
1 x FGC23929
$162.00
Haplogroup Info
Other products
Currencies