Top » Catalog » J1 » FGC50953

$18.00

FGC50953
[FGC50953]

FGC50953
hg38 Position: ChrY:19274548..19274548
Ancestral: T
Derived: G
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50953_F GAATTTCTCCCCCAAAATGG
Reverse Primer: FGC50953_R TTGCGCCTCTAATGATACCTG
Reviews

Customers who bought this product also purchased
FGC50950
FGC50950
FGC50949
FGC50949
FGC50948
FGC50948
FGC50954
FGC50954
FGC50952
FGC50952
FGC50951
FGC50951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
1 x FGC1707
$36.00
Haplogroup Info
Other products
Currencies