Top » Catalog » J1 » FGC50954

$18.00

FGC50954
[FGC50954]

FGC50954
hg38 Position: ChrY:19482494..19482494
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC50954_F GAGGTTTAGTTTTAGATTGTCAGTGTG
Reverse Primer: FGC50954_R CAGAAGTCCCCAATGACAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies